Find the answer to this question here. Super convenient online flashcards for studying and checking your answers!

(Correct Answer Below)

Reveal the answer to this question whenever you are ready.

Which Of The Following Two Molecules Of Dna Has The Lower Melting Temperature? Why?

hy? AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG AGGCGGGTAGGCACCCGTA TCCGCCCATCCGTGGGCAT
Front

Advertisement

1) The upper molecule, with a higher percentage of A-T base pairs, will have a lower melting temperature than that of the lower molecule which has mostly G-C pairs. The A-T base pairs have less stability than G-C bp as they have only 2 hydrogen bonds between them.

About the flashcard:

This flashcard is meant to be used for studying, quizzing and learning new information. Many scouting web questions are common questions that are typically seen in the classroom, for homework or on quizzes and tests. Flashcards vary depending on the topic, questions and age group. The cards are meant to be seen as a digital flashcard as they appear double sided, or rather hide the answer giving you the opportunity to think about the question at hand and answer it in your head or on a sheet before revealing the correct answer to yourself or studying partner. Some questions will include multiple choice options to show you the options involved and other questions will just have the questions and corrects answers. Simply reveal the answer when you are ready to check your work. Absolutely no cheating is acceptable.